Archives
FLAG tag Peptide (DYKDDDDK): High-Purity Epitope Tag for ...
FLAG tag Peptide (DYKDDDDK): High-Purity Epitope Tag for Recombinant Protein Purification
Executive Summary: The FLAG tag Peptide (DYKDDDDK) is an 8-amino acid synthetic peptide used as an epitope tag in recombinant protein expression systems (APExBIO). It features an enterokinase-cleavage site enabling gentle elution from anti-FLAG M1 and M2 affinity resins (Marcum & Radhakrishnan, 2019). The peptide exhibits high solubility (>210.6 mg/mL in water) and is supplied as a solid to maximize stability (APExBIO). Its >96.9% purity is confirmed by HPLC and mass spectrometry (see product documentation). The FLAG tag enables sensitive, specific detection and purification of recombinant proteins, but solutions should be used promptly to avoid degradation.
Biological Rationale
The FLAG tag Peptide (DYKDDDDK) is designed for use as an epitope tag in recombinant protein purification. Its amino acid sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) is highly hydrophilic, facilitating surface exposure and accessibility to antibodies or affinity resins (APExBIO). The tag’s small size minimizes interference with protein folding or function. Epitope tagging enables rapid, sequence-independent detection and purification of proteins in complex lysates, accelerating workflows in molecular and cellular biology (see contrast with workflow-focused review). In contrast to larger fusion tags, the FLAG tag’s minimal length reduces steric hindrance and immunogenicity, allowing for applications in both structural and functional assays.
Mechanism of Action of FLAG tag Peptide (DYKDDDDK)
The DYKDDDDK sequence is recognized with high specificity by monoclonal anti-FLAG M1 and M2 antibodies. These antibodies are covalently coupled to affinity resins for protein capture. The presence of an enterokinase recognition site (DDDDK) allows for enzymatic cleavage and gentle elution of the tagged protein under mild conditions, preserving protein activity and conformation (Marcum & Radhakrishnan, 2019). The mechanism ensures that elution is highly specific to FLAG-tagged proteins, minimizing co-purification of unrelated proteins. This tag does not interact with 3X FLAG variants; a distinct 3X FLAG peptide is required for those constructs (APExBIO).
Evidence & Benchmarks
- FLAG tag (DYKDDDDK) enables rapid and high-yield purification of recombinant proteins with minimal off-target binding (Marcum & Radhakrishnan, 2019).
- The peptide is highly soluble: >210.6 mg/mL in water, >50.65 mg/mL in DMSO, and >34.03 mg/mL in ethanol at room temperature (APExBIO).
- Purity exceeds 96.9%, as assessed by HPLC and mass spectrometry (APExBIO product QC; see product page).
- The DYKDDDDK epitope is compatible with anti-FLAG M1/M2 affinity resins and supports enzymatic elution via enterokinase (mechanistic review).
- In large-scale studies of chromatin remodeling complexes, FLAG-tagged proteins enabled efficient co-immunoprecipitation and pulldown for HDAC complex analysis (Marcum & Radhakrishnan, 2019).
Applications, Limits & Misconceptions
The FLAG tag Peptide (DYKDDDDK) is used in:
- Affinity purification of recombinant proteins in prokaryotic and eukaryotic expression systems.
- Detection of tagged proteins via Western blot, ELISA, and immunofluorescence assays.
- Co-immunoprecipitation and pulldown of protein complexes for interactome studies.
- Enzymatic cleavage and elution of proteins under non-denaturing conditions.
Common Pitfalls or Misconceptions
- The FLAG tag Peptide (DYKDDDDK) does not elute 3X FLAG fusion proteins; a 3X FLAG peptide is required for those applications (APExBIO).
- Long-term storage of FLAG tag peptide solutions is not recommended; use freshly prepared solutions to avoid hydrolysis and degradation.
- High concentrations of detergents or reducing agents may interfere with anti-FLAG antibody binding and reduce purification efficiency.
- Expression of the FLAG tag at non-terminal positions may affect accessibility depending on protein folding.
- Some anti-FLAG antibodies bind only native (not denatured) epitopes; choose detection reagents accordingly.
Workflow Integration & Parameters
For optimal use, dissolve the solid peptide in water, DMSO, or ethanol to the desired working concentration (typically 100 μg/mL). Store solid peptide desiccated at -20°C; promptly use solutions. The sequence DYKDDDDK can be genetically encoded at the N- or C-terminus of the target protein using standard cloning methods (see our article for advanced integration strategies not covered here). Purification is performed by binding to anti-FLAG M1 or M2 affinity resin, washing, and eluting with excess FLAG tag peptide or by enterokinase cleavage. For nucleic acid sequence design, the FLAG tag DNA sequence (GACTACAAGGACGACGATGACAAG) and nucleotide sequence can be codon-optimized for the host organism. Shipping is on blue ice to ensure stability for small molecules (APExBIO).
This article extends the practical workflow focus presented in "FLAG tag Peptide: Precision Epitope Tag for Recombinant Protein Purification" by providing detailed solubility, purity, and storage guidelines for the APExBIO A6002 product. For a deeper mechanistic perspective, see "FLAG tag Peptide (DYKDDDDK): Precision Epitope Tag for Recombinant Protein Purification", which this article updates with recent purity and compatibility data.
Conclusion & Outlook
The FLAG tag Peptide (DYKDDDDK) offers unmatched specificity, solubility, and workflow flexibility for recombinant protein purification and detection. Its biophysical and biochemical properties are validated in both small- and large-scale workflows, including complex chromatin studies (Marcum & Radhakrishnan, 2019). As new applications in interactomics and proteomics emerge, the robust performance of the FLAG tag continues to support the needs of advanced protein science. For more information or to purchase, visit the APExBIO FLAG tag Peptide (DYKDDDDK) product page.